Gene name |
SPBC29A10.15 |
Gene ID |
51/E07 |
Gene synonyms/obsolete |
orc1; orp1 |
Gene product |
origin recognition
complex (subunit 1); involved in S phase checkpoint
(required); AT hook protein; AAA family ATPase; BAH domain;
Cdc18/Cdc6 family of S-phase regulators |
Entry clone |
Cloned |
ORF length (unspliced) |
2176 |
ORF length (spliced) |
2124 |
Entry clone length |
2176 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPBC29A10.15.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCCTAGAAGAAAGTCATT |
Rev primer name |
SPBC29A10.15.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATGCTATCCCAGCAAGTTCC |
Amino acid length |
707 |
Molecular weight |
80.5 |
Isoelectric point (calc.) |
7.4 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LSNRISSRLGL |
Localization (YFP) |
nucleus; nuclear
dots |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Zeiss, DeltaVision
|