| Gene name |
SPBC29A10.15 |
| Gene ID |
51/E07 |
| Gene synonyms/obsolete |
orc1; orp1 |
| Gene product |
origin recognition
complex (subunit 1); involved in S phase checkpoint
(required); AT hook protein; AAA family ATPase; BAH domain;
Cdc18/Cdc6 family of S-phase regulators |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2176 |
| ORF length (spliced) |
2124 |
| Entry clone length |
2176 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPBC29A10.15.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCCTAGAAGAAAGTCATT |
| Rev primer name |
SPBC29A10.15.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATGCTATCCCAGCAAGTTCC |
| Amino acid length |
707 |
| Molecular weight |
80.5 |
| Isoelectric point (calc.) |
7.4 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LSNRISSRLGL |
| Localization (YFP) |
nucleus; nuclear
dots |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Zeiss, DeltaVision
|