| Gene name |
SPCC188.02 |
| Gene ID |
51/E08 |
| Gene synonyms/obsolete |
par1 |
| Gene product |
protein phosphatase
PP2A, subunit B'; involved in cytokinesis; involved in
cellular morphogenesis; involved in stress tolerance;
implicated in the regulation of the septation initiation
network |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2202 |
| ORF length (spliced) |
1647 |
| Entry clone length |
2202 |
| No. of intron |
5 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPCC188.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAAGGGATTAAAAGCAA |
| Rev primer name |
SPCC188.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAACCATTGGTGTAGTCAAGT |
| Amino acid length |
548 |
| Molecular weight |
63.3 |
| Isoelectric point (calc.) |
6.6 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
494 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytosol; SPB;
periphery at site of septum formation |
| Comments for localization |
|
| Effect of LMB on protein
localization |
changed to:
intranuclear microtubule bundle (nucleus; periphery at site of
septum formation) |
| Microscope used for
observation |
Zeiss |