| Gene name |
SPAC17H9.01 |
| Gene ID |
48/E01 |
| Gene synonyms/obsolete |
cid16 |
| Gene product |
nucleotidyltransferase; caffeine induced death
protein; cid1-related; non-essential; no apparent Sc
ortholog |
| Entry clone |
Cloned |
| ORF length (unspliced) |
3609 |
| ORF length (spliced) |
|
| Entry clone length |
3609 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
2885T:C |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC17H9.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCTATTTGCCAAATTATT |
| Rev primer name |
SPAC17H9.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTGAATCAAGGGATCCAGT |
| Amino acid length |
1202 |
| Molecular weight |
138.5 |
| Isoelectric point (calc.) |
9.1 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LEEIENLWL/LDAVMTLIL |
| Localization (YFP) |
a few cytoplasmic
dots |
| Comments for localization |
mitochondrion? |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |