Gene name |
SPAC17H9.01 |
Gene ID |
48/E01 |
Gene synonyms/obsolete |
cid16 |
Gene product |
nucleotidyltransferase; caffeine induced death
protein; cid1-related; non-essential; no apparent Sc
ortholog |
Entry clone |
Cloned |
ORF length (unspliced) |
3609 |
ORF length (spliced) |
|
Entry clone length |
3609 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
2885T:C |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAC17H9.01.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCTATTTGCCAAATTATT |
Rev primer name |
SPAC17H9.01.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATTGAATCAAGGGATCCAGT |
Amino acid length |
1202 |
Molecular weight |
138.5 |
Isoelectric point (calc.) |
9.1 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LEEIENLWL/LDAVMTLIL |
Localization (YFP) |
a few cytoplasmic
dots |
Comments for localization |
mitochondrion? |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |