| Gene name |
SPAC22G7.04 |
| Gene ID |
48/D12 |
| Gene synonyms/obsolete |
ubp13 |
| Gene product |
WD repeat protein
(SMART); ubiquitin C-terminal hydrolase activity; involved in
polyadenylation; exonuclease domain |
| Entry clone |
Cloned |
| ORF length (unspliced) |
3586 |
| ORF length (spliced) |
3348 |
| Entry clone length |
3586 |
| No. of intron |
6 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC22G7.04.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATGCGTGGAAAGAAGT |
| Rev primer name |
SPAC22G7.04.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATTTGTCTGATTAGATATG |
| Amino acid length |
1115 |
| Molecular weight |
126.9 |
| Isoelectric point (calc.) |
6.1 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytoplasmic dots
|
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |