| Gene name |
SPAC9G1.10c |
| Gene ID |
48/E02 |
| Gene synonyms/obsolete |
|
| Gene product |
inositol polyphosphate
phosphatase |
| Entry clone |
Cloned |
| ORF length (unspliced) |
3613 |
| ORF length (spliced) |
3576 |
| Entry clone length |
3613 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC9G1.10.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCCTCTCGCCAAGGCTT |
| Rev primer name |
SPAC9G1.10.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAACTTGACACTTGCTTTAAA |
| Amino acid length |
1191 |
| Molecular weight |
131.2 |
| Isoelectric point (calc.) |
8.3 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytoplasmic dots at
cell tip and site of septum formation; cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
changed to:
intranuclear microtubule bundle (cytoplasmic dots at site of
septum formation and cell tip; nucleus>>cytosol) |
| Microscope used for
observation |
Leica |