Gene name |
SPAC17A5.16 |
Gene ID |
48/B06 |
Gene synonyms/obsolete |
|
Gene product |
conserved eukaryotic
protein; no apparent Sc ortholog |
Entry clone |
Cloned |
ORF length (unspliced) |
3255 |
ORF length (spliced) |
2778 |
Entry clone length |
3255 |
No. of intron |
7 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAC17A5.16.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGAGGCCAAGAGTCAAA |
Rev primer name |
SPAC17A5.16.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACTTGTTGCGTAAACTGGAA |
Amino acid length |
925 |
Molecular weight |
104.8 |
Isoelectric point (calc.) |
6.5 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LYSLINTTLRL/LTSQILLLFL/LSPVILLTI/LDKLDLLYL |
Localization (YFP) |
Golgi; cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
changed to:
cytosol=nucleus; Golgi |
Microscope used for
observation |
Leica |