Gene name |
SPAC167.01 |
Gene ID |
48/B07 |
Gene synonyms/obsolete |
|
Gene product |
serine/threonine
protein kinase; involved in unfolded protein response |
Entry clone |
Cloned |
ORF length (unspliced) |
3269 |
ORF length (spliced) |
3219 |
Entry clone length |
3269 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAC167.01.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAGAGTTTGAAAGGGCG |
Rev primer name |
SPAC167.01.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAATACTCTAGATAACGTTTA |
Amino acid length |
1072 |
Molecular weight |
121.2 |
Isoelectric point (calc.) |
6.6 |
Signal SEQ |
Predicted
(N-terminus) |
No. of transmembrane domain |
2 |
NLS position (Columbia Univ.
Bioinformatics Center) |
568 |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LRKFVFFSLLI |
Localization (YFP) |
ER |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |