| Gene name |
SPAPJ760.02c |
| Gene ID |
47/A08 |
| Gene synonyms/obsolete |
app1 |
| Gene product |
actin-binding protein;
actin cortical patch component; involved in endocytosis;
cofilin/tropomyosin N-terminal domain; src (SH3) homology
domain; divergent repeat containing consensus
PVVPE[VA]PSVPQPP[AV][AV] (10) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2639 |
| ORF length (spliced) |
2574 |
| Entry clone length |
2639 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAPJ760.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCATTTCAACTAGATAC |
| Rev primer name |
SPAPJ760.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAATTTCCTCTACATAATTT |
| Amino acid length |
857 |
| Molecular weight |
91.1 |
| Isoelectric point (calc.) |
4.8 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytoplasmic dots at
cell tip and site of septum formation |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |