| Gene name |
SPCC18B5.03 |
| Gene ID |
47/A06 |
| Gene synonyms/obsolete |
wee1 |
| Gene product |
serine/threonine
protein kinase; dual specificity protein kinase; mitotic
inhibitor; CDK tyrosine kinase; negatively regulates G2/M
transition; phosphorylates Cdc2p; overexpression results in
cell cycle defects; involved in control of mitosis; involved
in DNA damage checkpoint; involved in DNA replication
checkpoint |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2634 |
| ORF length (spliced) |
|
| Entry clone length |
2634 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPCC18B5.03.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGCTCTTCTTCTAATAC |
| Rev primer name |
SPCC18B5.03.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAACATTCACCTGCCAATCT |
| Amino acid length |
877 |
| Molecular weight |
96.2 |
| Isoelectric point (calc.) |
9.9 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
SPB |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |