Gene name |
SPBC3B8.02 |
Gene ID |
40/D11 |
Gene synonyms/obsolete |
php5 |
Gene product |
CCAAT-box binding
factor subunit; involved in growth on non-fermentable carbon
sources (required); DNA-binding activity (required); histone
fold; involved in the transcriptional activation (of cyc1)
(required); histone-like transcription factor family |
Entry clone |
Cloned |
ORF length (unspliced) |
1351 |
ORF length (spliced) |
1248 |
Entry clone length |
1351 |
No. of intron |
2 |
Sequence status |
Finished |
Sequence results |
165T:C / 207T:C /
1219G:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC3B8.02.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAATTCTATTCCTGATTC |
Rev primer name |
SPBC3B8.02.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACTGGGGTTGTTGCGAATAG |
Amino acid length |
415 |
Molecular weight |
46.6 |
Isoelectric point (calc.) |
7.9 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
160 |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
cytoplasmic dots;
nuclear dots |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |