| Gene name |
SPBC17G9.09 |
| Gene ID |
40/D10 |
| Gene synonyms/obsolete |
tif213 |
| Gene product |
translation initiation
factor 2 (gamma subunit) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1341 |
| ORF length (spliced) |
|
| Entry clone length |
1341 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC17G9.09.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCGGAAAATCTTGATAT |
| Rev primer name |
SPBC17G9.09.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAACTTTTAGAGTCTTACCC |
| Amino acid length |
446 |
| Molecular weight |
48.7 |
| Isoelectric point (calc.) |
8.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LSGNVDPLPI/LKEAVLCLAL |
| Localization (YFP) |
cytosol; cytoplasmic
dots |
| Comments for localization |
aggregates by over
expression |
| Effect of LMB on protein
localization |
changed to:
cytosol=nucleus; cytoplasmic dots |
| Microscope used for
observation |
DeltaVision |