| Gene name |
SPBC2D10.12 |
| Gene ID |
40/D09 |
| Gene synonyms/obsolete |
rhp23 |
| Gene product |
involved in DNA
repair; involved in nucleotide-excision repair; similar to
human HHR23A; ubiquitin family protein; UBA domain; involved
in cell cycle control; involved in protein ubiquitination;
involved in protein deubiquitination; ubiquitin-binding
protein |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1287 |
| ORF length (spliced) |
1107 |
| Entry clone length |
1287 |
| No. of intron |
4 |
| Sequence status |
Finished |
| Sequence results |
906A:G /
1186T:addition |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC2D10.12.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAATTTGACATTCAAAAA |
| Rev primer name |
SPBC2D10.12.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGGTTCATCCTCAGATTCA |
| Amino acid length |
368 |
| Molecular weight |
40.1 |
| Isoelectric point (calc.) |
4.1 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nuclear envelope;
nucleus>>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |