Gene name |
SPAC19A8.02 |
Gene ID |
39/C06 |
Gene synonyms/obsolete |
|
Gene product |
hypothetical protein
involved in transcriptional activation; pleckstrin homology
domain; possibly protein kinase interacting |
Entry clone |
Cloned |
ORF length (unspliced) |
3740 |
ORF length (spliced) |
3642 |
Entry clone length |
3740 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
960T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC19A8.02.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCCGCTCCTGCAAATGC |
Rev primer name |
SPAC19A8.02.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATGCAGCGTAGTCTGCGTTT |
Amino acid length |
1213 |
Molecular weight |
140.5 |
Isoelectric point (calc.) |
9.1 |
Signal SEQ |
|
No. of transmembrane domain |
1 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LRKFIVAPLDL |
Localization (YFP) |
periphery |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |