Gene name |
SPAC6G10.05c |
Gene ID |
39/C05 |
Gene synonyms/obsolete |
|
Gene product |
hypothetical protein
TRAPP; involved in intracellular protein transport |
Entry clone |
Cloned |
ORF length (unspliced) |
3739 |
ORF length (spliced) |
3633 |
Entry clone length |
3739 |
No. of intron |
2 |
Sequence status |
Finished |
Sequence results |
1751T:C / 1826T:C /
3284A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC6G10.05.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAATTTGATTTTTTTTC |
Rev primer name |
SPAC6G10.05.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACTTCGCATCAACAATTAGT |
Amino acid length |
1210 |
Molecular weight |
137.7 |
Isoelectric point (calc.) |
7.5 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LELFTVCLVI/LSDEMANNLSI |
Localization (YFP) |
SPB?; periphery at
site of septum formation |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |