| Gene name |
SPBC530.06c |
| Gene ID |
39/C04 |
| Gene synonyms/obsolete |
|
| Gene product |
putative eukaryotic
translation initiation eukaryotic translation initiation
factor 3 (alpha subunit) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
3710 |
| ORF length (spliced) |
3523 |
| Entry clone length |
3710 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
1437A:G /
2438T:C |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPBC530.06.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTACAATAGGTATGAA |
| Rev primer name |
SPBC530.06.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGTCCGAGATTGTCTTTCT |
| Amino acid length |
|
| Molecular weight |
|
| Isoelectric point (calc.) |
|
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LLYLTVLTI/LSPLFKERLHL/LSRISDLLHI |
| Localization (YFP) |
no apparent
signal |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
Leica |