Gene name |
SPAC11E3.02c |
Gene ID |
39/C07 |
Gene synonyms/obsolete |
|
Gene product |
hypothetical protein
C2 domain; similar to Sp SPBC21C3.20C; similar to N. crassa
NCU02833.1 |
Entry clone |
Cloned |
ORF length (unspliced) |
3760 |
ORF length (spliced) |
3714 |
Entry clone length |
3760 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
2106A:G /
2856A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC11E3.02.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAATTGTAGACGAAAACC |
Rev primer name |
SPAC11E3.02.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACCGGGAATCCAGCTTTTTT |
Amino acid length |
1237 |
Molecular weight |
142.9 |
Isoelectric point (calc.) |
7.5 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LKNVLILFL |
Localization (YFP) |
periphery at cell tip
and site of septum formation; cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |