| Gene name |
SPAC11E3.02c |
| Gene ID |
39/C07 |
| Gene synonyms/obsolete |
|
| Gene product |
hypothetical protein
C2 domain; similar to Sp SPBC21C3.20C; similar to N. crassa
NCU02833.1 |
| Entry clone |
Cloned |
| ORF length (unspliced) |
3760 |
| ORF length (spliced) |
3714 |
| Entry clone length |
3760 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
2106A:G /
2856A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC11E3.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAATTGTAGACGAAAACC |
| Rev primer name |
SPAC11E3.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACCGGGAATCCAGCTTTTTT |
| Amino acid length |
1237 |
| Molecular weight |
142.9 |
| Isoelectric point (calc.) |
7.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LKNVLILFL |
| Localization (YFP) |
periphery at cell tip
and site of septum formation; cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |