| Gene name |
SPAC922.08c |
| Gene ID |
35/H10 |
| Gene synonyms/obsolete |
SPAC869.11 |
| Gene product |
APC amino acid
transporter (putative); similar to Sp SPBC359.01C and
SPBC359.03C and SPAP7G5.06 and SPBPB2B2.01 and ISP5(paralog);
closely related paralogous family; amino acid permease family;
similar to Sp SPAP7G5.06 and SPBC359.01 and meu22 and
SPBPB2B2.01 and isp5 |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1743 |
| ORF length (spliced) |
|
| Entry clone length |
1743 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC922.08.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAACCAGAATATGTCTC |
| Rev primer name |
SPAC922.08.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAACAGAAAACCGAACTGATT |
| Amino acid length |
580 |
| Molecular weight |
63.6 |
| Isoelectric point (calc.) |
7.9 |
| Signal SEQ |
|
| No. of transmembrane domain |
11 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
periphery; cytoplasmic
dots |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |