| Gene name |
SPAC1039.09 |
| Gene ID |
35/H09 |
| Gene synonyms/obsolete |
isp5 |
| Gene product |
involved in sexual
differentiation; amino acid permease family; similar to Sp
SPAP7G5.06 and SPAC869.11 and SPBC359.01 and SPBC359.01 and
meu22 and SPBPB2B2.01 |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1743 |
| ORF length (spliced) |
|
| Entry clone length |
1743 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
26T:C / 1436T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC1039.09.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAATAATTACGGGGTCTC |
| Rev primer name |
SPAC1039.09.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAACGCAGAAAGATAGGACG |
| Amino acid length |
580 |
| Molecular weight |
63.8 |
| Isoelectric point (calc.) |
8.3 |
| Signal SEQ |
|
| No. of transmembrane domain |
12 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LALFVVSLLI/LATLFVWLSI |
| Localization (YFP) |
ER |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |