| Gene name |
SPAC27E2.09 |
| Gene ID |
34/C08 |
| Gene synonyms/obsolete |
mak2 |
| Gene product |
histidine kinase;
involved in signal transduction; His-to-Asp phosphorelay;
non-essential; functions upstream of Spy1p; function
overlapping with Mak1p and Mak3p; implicated in mitotic cell
cycle control; implicated in oxidative stress response;
required for the regulation of sexual development; PAC domain
protein; similar to Sp mak1 and mak3; response regulator
receiver domain |
| Entry clone |
Cloned in 2006
trial |
| ORF length (unspliced) |
6933 |
| ORF length (spliced) |
|
| Entry clone length |
6933 |
| No. of intron |
0 |
| Sequence status |
Partially
sequenced |
| Sequence results |
100% match in both
ends |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC27E2.09.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGCTTGTACAAGTCATT |
| Rev primer name |
SPAC27E2.09.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAACGAGCACTCTTCTCCAAA |
| Amino acid length |
2310 |
| Molecular weight |
264.6 |
| Isoelectric point (calc.) |
7.4 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LGFMVCLLEI/LGNYMEALRL/LLTTVIKLVI/LLNLKTLEL |
| Localization (YFP) |
no expression clone
|
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
|