| Gene name |
SPAC22G7.06c |
| Gene ID |
34/C07 |
| Gene synonyms/obsolete |
ura1 |
| Gene product |
ATP-binding protein;
involved in glutamate metabolism; involved in pyrimidine base
biosynthesis; involved in aspartate metabolism;
carbamoyl-phosphate synthase (glutamine hydrolyzing) activity;
aspartate carbamoyltransferase activity; transferase activity,
transferring pentosyl groups; dihydroorotase activity |
| Entry clone |
Cloned; Mixture |
| ORF length (unspliced) |
6735 |
| ORF length (spliced) |
|
| Entry clone length |
6735 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
Mixture |
| Comments |
Mixture of 2 clones,
one of which is frameshifted from somewhere. |
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC22G7.06.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCCGGATTGCTACCTTC |
| Rev primer name |
SPAC22G7.06.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATTTGCTACTTCAGTAGCA |
| Amino acid length |
2244 |
| Molecular weight |
248.3 |
| Isoelectric point (calc.) |
5.7 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LSAVKKLAL/LGSVNGLTI |
| Localization (YFP) |
cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |