| Gene name |
SPBC646.01c |
| Gene ID |
34/C09 |
| Gene synonyms/obsolete |
tor2;
SPBC216.07c |
| Gene product |
phosphatidylinositol
kinase; similar to Sp TOR1 (paralog); involved in starvation
response (required); involved in stress response |
| Entry clone |
Cloned |
| ORF length (unspliced) |
7014 |
| ORF length (spliced) |
|
| Entry clone length |
7014 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
489T:C / 3778T:C /
4331A:G / 5638T:A / 7007T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC646.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAAGAATTTCCTGGGTT |
| Rev primer name |
SPBC646.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACCAGAAACTACACCAGCCA |
| Amino acid length |
2337 |
| Molecular weight |
266.3 |
| Isoelectric point (calc.) |
7.1 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LRKIMLKTLTI/LEFYFQQLSI/LPSLLVMMLQI/LQDTLRLLNL/LPQLTTLDL/LLHVHDLEL/LFGLCNNLLL/LLNIEHRLII |
| Localization (YFP) |
cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |