| Gene name |
SPBC1347.02 |
| Gene ID |
32/D11 |
| Gene synonyms/obsolete |
fkbp39 |
| Gene product |
peptidyl-prolyl
cis-trans isomerase (FKBP-type); similar to Sp SPAC27F1.06C
(paralog) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1086 |
| ORF length (spliced) |
|
| Entry clone length |
1086 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
121T:C / 393A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC1347.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTCTTCCAATTGCTGT |
| Rev primer name |
SPBC1347.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGTGAACGCGAACAAGCTTG |
| Amino acid length |
361 |
| Molecular weight |
39.3 |
| Isoelectric point (calc.) |
4.3 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
183 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleolus |
| Comments for localization |
bright signal |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |