| Gene name |
SPAC6F6.15 |
| Gene ID |
32/D12 |
| Gene synonyms/obsolete |
ypt5 |
| Gene product |
small GTPase; Rab
subfamily; GTP-binding protein; post-translational
modification, gerenylgerenylation @ C-terminal CXC;
post-translational modification, carboxymethylation; involved
in regulation of endosome fusion, the regulation of
intracellular protein transport; functionally complemented by
mammalian rab5; non-essential |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1089 |
| ORF length (spliced) |
636 |
| Entry clone length |
1089 |
| No. of intron |
7 |
| Sequence status |
Finished |
| Sequence results |
36A:G / 493G:A /
712A:G / 878A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC6F6.15.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCATCAAATACAGCTCC |
| Rev primer name |
SPAC6F6.15.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGCAAGAGCATGAACCGCTT |
| Amino acid length |
211 |
| Molecular weight |
22.9 |
| Isoelectric point (calc.) |
5.4 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LFTAIAKKLPL |
| Localization (YFP) |
cytosol=nucleus |
| Comments for localization |
bright signal |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |