| Gene name |
SPAC23D3.13c |
| Gene ID |
31/A10 |
| Gene synonyms/obsolete |
|
| Gene product |
conserved protein; Sc
deletion hypersensitive to brefeldin A or monensin, two drugs
that affect intracellular transport |
| Entry clone |
Cloned |
| ORF length (unspliced) |
5006 |
| ORF length (spliced) |
4851 |
| Entry clone length |
5006 |
| No. of intron |
3 |
| Sequence status |
Finished |
| Sequence results |
3771A:G /
4229T:A |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC23D3.13.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGTTTATATGATAGTCT |
| Rev primer name |
SPAC23D3.13.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAATTGCGTTCAACACCTCA |
| Amino acid length |
1616 |
| Molecular weight |
181.4 |
| Isoelectric point (calc.) |
5.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LNSIQLLAI/LEEAFQLMLRL/LDVDFLSSLQL/LNAILGQLTL |
| Localization (YFP) |
Golgi; cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
changed to:
cytosol=nucleus; Golgi |
| Microscope used for
observation |
Leica |