| Gene name |
SPBC31E1.01c |
| Gene ID |
31/A11 |
| Gene synonyms/obsolete |
SPBC660.18c |
| Gene product |
zinc finger protein;
zf-fungal Zn(2)-Cys(6) binuclear cluster domain; involved in
autophagy, sporulation, and protein-vacuolar targeting |
| Entry clone |
#Not cloned yet |
| ORF length (unspliced) |
5011 |
| ORF length (spliced) |
4941 |
| Entry clone length |
5011 |
| No. of intron |
1 |
| Sequence status |
#Not cloned yet |
| Sequence results |
Not cloned yet |
| Comments |
|
| Polymerase used for cloning |
|
| Fwd primer name |
SPBC31E1.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGGTTACCCTCATGGCT |
| Rev primer name |
SPBC31E1.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAACCAGGCCGTTTGTATTTC |
| Amino acid length |
1646 |
| Molecular weight |
184.3 |
| Isoelectric point (calc.) |
4.8 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
no apparent
signal |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
Leica |