| Gene name |
SPAC10F6.15 |
| Gene ID |
22/E08 |
| Gene synonyms/obsolete |
B8647-4 |
| Gene product |
Sp specific families;
Pfam-B_8647 domain |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1299 |
| ORF length (spliced) |
|
| Entry clone length |
1299 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
134A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC10F6.15.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAACTATAATGCAAATGT |
| Rev primer name |
SPAC10F6.15.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTCAGCAGGTATAATCAGT |
| Amino acid length |
432 |
| Molecular weight |
49.4 |
| Isoelectric point (calc.) |
7.1 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytoplasmic dots at
periphery |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |