| Gene name |
SPAC3F10.17 |
| Gene ID |
22/E07 |
| Gene synonyms/obsolete |
|
| Gene product |
conserved
hypothetical; involved in stress response |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1297 |
| ORF length (spliced) |
1161 |
| Entry clone length |
1297 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
76T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC3F10.17.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGTAAGAAATGAATAAAA |
| Rev primer name |
SPAC3F10.17.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAATCCTAGCACGCCCAAGC |
| Amino acid length |
386 |
| Molecular weight |
44.4 |
| Isoelectric point (calc.) |
4.4 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
108 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytosol=nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
changed to:
intranuclear microtubule bundle (nucleus) |
| Microscope used for
observation |
Leica |