| Gene name |
SPCC320.13c |
| Gene ID |
18/C05 |
| Gene synonyms/obsolete |
ark1; SPCC330.16 |
| Gene product |
serine/threonine
protein kinase; aurora homolog; involved in spindle assembly
checkpoint; involved in spindle formation (required); involved
in sister chromatid separation (required); involved in
microtubule attachment (required); interacts physically and/or
genetically with the inner centromere protein Pic1p; interacts
physically and/or genetically with the inner centromere
protein Bir1p; interacts physically and/or genetically with
survivin; involved in protein amino acid phosphorylation
(SER10 of Hht3p) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1155 |
| ORF length (spliced) |
|
| Entry clone length |
1155 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC330.16.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGTGTTACCTCAAAATGT |
| Rev primer name |
SPCC330.16.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGGAAGATTCAGAACTTTTG |
| Amino acid length |
384 |
| Molecular weight |
43.8 |
| Isoelectric point (calc.) |
10.3 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
no apparent
signal |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
Confocal
|