| Gene name |
SPBC4F6.05c |
| Gene ID |
18/C04 |
| Gene synonyms/obsolete |
|
| Gene product |
lectin predicted;
predicted N-terminal signal sequence; 1 predicted
transmembrane helix; cargo receptor for glycoproteins;
involved in intracellular protein transport; involved in ER to
Golgi transport; involved in secretory pathway; COPII-coated
vesicle component; |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1155 |
| ORF length (spliced) |
|
| Entry clone length |
1155 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC4F6.05.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAGTTTTGCTCCCTGTT |
| Rev primer name |
SPBC4F6.05.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATAAGTATTTATGTCTTCTG |
| Amino acid length |
384 |
| Molecular weight |
42.7 |
| Isoelectric point (calc.) |
5.2 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
1 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LVALSNLNI/LTNFMVFLLL |
| Localization (YFP) |
ER; Golgi |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |