| Gene name |
SPCC364.02c |
| Gene ID |
18/C06 |
| Gene synonyms/obsolete |
bis1 |
| Gene product |
involved in stress
response; interacts physically with Isp1p; overexpression
results in a cell elongation phenotype; ES2 nuclear protein
family; deleted in DiGeorge syndrome homolog; deletion mutant
results in reduced viability in stationary phase; no apparent
Sc ortholog |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1155 |
| ORF length (spliced) |
|
| Entry clone length |
1155 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC364.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCCTTGGCAAAAAAGAT |
| Rev primer name |
SPCC364.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAACCCTTTTAGGTGTAGGG |
| Amino acid length |
384 |
| Molecular weight |
43 |
| Isoelectric point (calc.) |
9.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
279 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LRKRLPSLAI |
| Localization (YFP) |
SPB?; nucleus |
| Comments for localization |
SPB by over
expression?; SPB of abnormal spindle? |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |