| Gene name |
SPAC24H6.01c |
| Gene ID |
51/E04 |
| Gene synonyms/obsolete |
SPAC23E2.04c;
SPAPB21F2.01 |
| Gene product |
hypothetical
protein |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1965 |
| ORF length (spliced) |
1767 |
| Entry clone length |
1965 |
| No. of intron |
4 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC24H6.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTTACGTTTATTTCGATT |
| Rev primer name |
SPAC24H6.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTTACGCGAATTTGAAACA |
| Amino acid length |
588 |
| Molecular weight |
69 |
| Isoelectric point (calc.) |
9.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
9 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LFNITMLRL/LTYIFYAPLYL |
| Localization (YFP) |
cytosol? |
| Comments for localization |
too dark to
photo |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Zeiss |