| Gene name |
SPBC29A10.14 |
| Gene ID |
51/E03 |
| Gene synonyms/obsolete |
rec8 |
| Gene product |
involved in meiotic
recombination (required); cohesin complex (meiotic);
centromeric cohesin complex (meiotic); armassociated cohesin
complex (meiotic) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1873 |
| ORF length (spliced) |
1686 |
| Entry clone length |
1873 |
| No. of intron |
4 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPBC29A10.14.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTTTTACAATCAAGATGT |
| Rev primer name |
SPBC29A10.14.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAATGGCATCGGTGCTTTTT |
| Amino acid length |
561 |
| Molecular weight |
64 |
| Isoelectric point (calc.) |
5.4 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
280 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LALRLSSNLMI |
| Localization (YFP) |
nucleus; nuclear
dots |
| Comments for localization |
one nuclear
dot/nucleus |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Zeiss |