Gene name |
SPBC29A10.05 |
Gene ID |
51/E02 |
Gene synonyms/obsolete |
exo1 |
Gene product |
exonuclease I; XP-G
family; involved in DNA repair; involved in mismatch repair;
5'-3' exonuclease; functions in the same pathway as msh2 and
pms1 |
Entry clone |
Cloned |
ORF length (unspliced) |
1716 |
ORF length (spliced) |
|
Entry clone length |
1716 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPBC29A10.05.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGAATTAAAGGTCTTTT |
Rev primer name |
SPBC29A10.05.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAACGAAATTTATATTGCTGA |
Amino acid length |
571 |
Molecular weight |
63.8 |
Isoelectric point (calc.) |
9.9 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
89 |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LKYAIHQALML |
Localization (YFP) |
nucleus; nuclear dots;
spindle microtubules |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |