| Gene name |
SPCC11E10.09c |
| Gene ID |
51/E01 |
| Gene synonyms/obsolete |
SPCC188.01c |
| Gene product |
Sp specific families;
alpha-amylase; no apparent Sc orthologs |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1546 |
| ORF length (spliced) |
1437 |
| Entry clone length |
1546 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPCC11E10.09.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAATCTAATCTGCTCCAT |
| Rev primer name |
SPCC11E10.09.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATAGGAAGCTAGGGTCAGAG |
| Amino acid length |
478 |
| Molecular weight |
55.4 |
| Isoelectric point (calc.) |
6.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytosol=nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Zeiss |