| Gene name |
SPCC188.06c |
| Gene ID |
51/E05 |
| Gene synonyms/obsolete |
srp54 |
| Gene product |
signal sequence
binding activity; GTPase; essential; involved in intracellular
protein transport; involved in protein-ER targeting
(required); involved in SRP-dependent cotranslational membrane
targeting |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2049 |
| ORF length (spliced) |
1569 |
| Entry clone length |
2049 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPCC188.06.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGTTTTTGCAGATTTAGG |
| Rev primer name |
SPCC188.06.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAACGTCTTCGAGGAGGCTTT |
| Amino acid length |
522 |
| Molecular weight |
56.6 |
| Isoelectric point (calc.) |
9.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytosol; ER |
| Comments for localization |
|
| Effect of LMB on protein
localization |
changed to:
cytosol=nucleus; ER |
| Microscope used for
observation |
Zeiss |