Gene name |
SPCC188.06c |
Gene ID |
51/E05 |
Gene synonyms/obsolete |
srp54 |
Gene product |
signal sequence
binding activity; GTPase; essential; involved in intracellular
protein transport; involved in protein-ER targeting
(required); involved in SRP-dependent cotranslational membrane
targeting |
Entry clone |
Cloned |
ORF length (unspliced) |
2049 |
ORF length (spliced) |
1569 |
Entry clone length |
2049 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPCC188.06.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGTTTTTGCAGATTTAGG |
Rev primer name |
SPCC188.06.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAACGTCTTCGAGGAGGCTTT |
Amino acid length |
522 |
Molecular weight |
56.6 |
Isoelectric point (calc.) |
9.7 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
cytosol; ER |
Comments for localization |
|
Effect of LMB on protein
localization |
changed to:
cytosol=nucleus; ER |
Microscope used for
observation |
Zeiss |