Gene name |
SPAC12B10.14c |
Gene ID |
49/D04 |
Gene synonyms/obsolete |
|
Gene product |
serine/threonine
protein kinase; similar to Sp pak1 and shk2 (paralogs) |
Entry clone |
Cloned |
ORF length (unspliced) |
2056 |
ORF length (spliced) |
1998 |
Entry clone length |
2056 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
1741T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC12B10.14.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCTTTCCAATTCTACATT |
Rev primer name |
SPAC12B10.14.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATAGATAACTGTAGCGAGAT |
Amino acid length |
665 |
Molecular weight |
74.5 |
Isoelectric point (calc.) |
9.3 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
periphery at cell tip;
cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |