| Gene name |
SPAPB1A11.04c |
| Gene ID |
49/D05 |
| Gene synonyms/obsolete |
|
| Gene product |
transcriptional
regulator; zinc finger protein; zf-fungal Zn(2)-Cys(6)
binuclear cluster domain; similar to Sp SPAC1327.01C |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2094 |
| ORF length (spliced) |
|
| Entry clone length |
2094 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
367T:C / 785G:A |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAPB1A11.04.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGATTGCTGCTGTCGAAAA |
| Rev primer name |
SPAPB1A11.04.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACAATCGAATACTTCTTCCA |
| Amino acid length |
697 |
| Molecular weight |
79.2 |
| Isoelectric point (calc.) |
7.9 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LTNITCLLLL/LRMVDSLDL/LTYLLRNVLDL |
| Localization (YFP) |
no apparent
signal |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
Leica,
Confocal |