| Gene name |
SPBC691.02c |
| Gene ID |
49/D03 |
| Gene synonyms/obsolete |
pi034;
SPACTOKYO_453.01 |
| Gene product |
Rad50p interacting
protein; similar to human RINT-1 (a Rad50 interacting protein
which participates in radiation induced checkpoint control);
no apparent Sc ortholog |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2037 |
| ORF length (spliced) |
|
| Entry clone length |
2037 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
251A:G / 1593A:T |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC691.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGATGTCCCAACAGTTAAT |
| Rev primer name |
SPBC691.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATCCTTCCATGCATCAACT |
| Amino acid length |
678 |
| Molecular weight |
79.4 |
| Isoelectric point (calc.) |
4.8 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LMSTVELLSL |
| Localization (YFP) |
nucleus>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |