| Gene name |
SPAC1399.01c |
| Gene ID |
49/C09 |
| Gene synonyms/obsolete |
|
| Gene product |
purine permease; no
apparent Sc ortholog |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1806 |
| ORF length (spliced) |
|
| Entry clone length |
1806 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
1703T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC1399.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCGGAATCCATCCAAGA |
| Rev primer name |
SPAC1399.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAACAACCTTATCAACATCA |
| Amino acid length |
601 |
| Molecular weight |
64.5 |
| Isoelectric point (calc.) |
5 |
| Signal SEQ |
|
| No. of transmembrane domain |
12 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LNAKVPVLLAL |
| Localization (YFP) |
periphery;
vacuole |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Confocal |