| Gene name |
SPBPB2B2.06c |
| Gene ID |
49/C08 |
| Gene synonyms/obsolete |
|
| Gene product |
putative 5'
nucleotidase family protein; calcineurin-like
phosphodiesterase; similar to Sp SPAC1039.02 and SPAC17G6.03
|
| Entry clone |
Cloned |
| ORF length (unspliced) |
1806 |
| ORF length (spliced) |
|
| Entry clone length |
1806 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBPB2B2.06.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAGACAGCCTCGATACA |
| Rev primer name |
SPBPB2B2.06.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATCACAATTATCACTCCAT |
| Amino acid length |
601 |
| Molecular weight |
68.4 |
| Isoelectric point (calc.) |
4.6 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
1 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytosol=nucleus |
| Comments for localization |
except nucleolus |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Confocal |