| Gene name |
SPAPB1E7.03 |
| Gene ID |
49/C10 |
| Gene synonyms/obsolete |
|
| Gene product |
DNA directed RNA
polymerase III (C74 subunit) |
| Entry clone |
Cloned# |
| ORF length (unspliced) |
1855 |
| ORF length (spliced) |
1776 |
| Entry clone length |
1855 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAPB1E7.03.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCACAGTATGCTGTAGA |
| Rev primer name |
SPAPB1E7.03.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATAAATTATCCCTAAATACT |
| Amino acid length |
591 |
| Molecular weight |
68.3 |
| Isoelectric point (calc.) |
7.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
SPB?; nucleus; nuclear
dots |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |