Gene name |
SPAP32A8.03c |
Gene ID |
49/B02 |
Gene synonyms/obsolete |
|
Gene product |
zinc finger protein;
zf-C3HC4 type (RING finger); ubiquitin ligase (E3); no
apparent Sc ortholog |
Entry clone |
Cloned |
ORF length (unspliced) |
1701 |
ORF length (spliced) |
1542 |
Entry clone length |
1701 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
19A:C / 1026T:C /
1143T:C / 1209T:C / 1224C:T / 1620T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAP32A8.03.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAGTCCCAACCGGTCAT |
Rev primer name |
SPAP32A8.03.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACTCCAAAGGCTCCTCATCA |
Amino acid length |
513 |
Molecular weight |
55.1 |
Isoelectric point (calc.) |
4.3 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
no apparent
signal |
Comments for localization |
|
Effect of LMB on protein
localization |
not determined |
Microscope used for
observation |
DeltaVision |