Gene name |
SPAC12B10.16c |
Gene ID |
49/B01 |
Gene synonyms/obsolete |
|
Gene product |
hypothetical protein;
no apparent Sc ortholog; conserved in bacteria |
Entry clone |
Cloned |
ORF length (unspliced) |
1695 |
ORF length (spliced) |
1530 |
Entry clone length |
1695 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
1507A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC12B10.16.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAATATTGGCAGGCAAT |
Rev primer name |
SPAC12B10.16.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATGATGCATTCTTCTTTAAC |
Amino acid length |
509 |
Molecular weight |
57.1 |
Isoelectric point (calc.) |
5.7 |
Signal SEQ |
Predicted
(N-terminus) |
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LDSLASFLKL |
Localization (YFP) |
ER |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |