| Gene name |
SPAC1783.05 |
| Gene ID |
48/G01 |
| Gene synonyms/obsolete |
hrp1; chd1 |
| Gene product |
chromatin remodeling
ATPase; involved in transcription termination; involved in
chromosome segregation; involved in mitosis; DNA-binding
domain binds AT-rich stretches; DEAD/DEAH box helicase; SNF2
family; helicase C-terminal domain; similar to Sp hrp3 |
| Entry clone |
Cloned; Mixture |
| ORF length (unspliced) |
4122 |
| ORF length (spliced) |
|
| Entry clone length |
4122 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
3808G:A |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC1783.05.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAGCCTGAACATTCGAA |
| Rev primer name |
SPAC1783.05.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATGCCTCGTTTTTTACTAAG |
| Amino acid length |
1373 |
| Molecular weight |
158.5 |
| Isoelectric point (calc.) |
5.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
1243 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
no apparent
signal |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
DeltaVision |