| Gene name |
SPCC63.04 |
| Gene ID |
48/F12 |
| Gene synonyms/obsolete |
mok14 |
| Gene product |
a-1,3-glucan synthase;
alpha glucan synthase; glycosyl transferase family 1; similar
to Sp MOK1 and MOK11 and MOK13 and MOK12; involved in cell
wall biosynthesis; no apparent Sc ortholog |
| Entry clone |
#Not cloned yet |
| ORF length (unspliced) |
4110 |
| ORF length (spliced) |
|
| Entry clone length |
4110 |
| No. of intron |
0 |
| Sequence status |
#Not cloned yet |
| Sequence results |
#Not cloned yet |
| Comments |
|
| Polymerase used for cloning |
|
| Fwd primer name |
SPCC63.04.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAATATAAAGAAAAAGAG |
| Rev primer name |
SPCC63.04.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACGGTCTGCTAATGTTTTCT |
| Amino acid length |
1369 |
| Molecular weight |
156.1 |
| Isoelectric point (calc.) |
8.6 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
13 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LREVTFALFI/LPSVHSLSL/LQGVQQLWL/LSRALWLWLGI |
| Localization (YFP) |
not cloned |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
|