Gene name |
SPAC26H5.01c |
Gene ID |
48/C02 |
Gene synonyms/obsolete |
SPAC23A1.19c |
Gene product |
DEAD/DEAH box
helicase |
Entry clone |
Cloned |
ORF length (unspliced) |
3367 |
ORF length (spliced) |
3192 |
Entry clone length |
3367 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAC26H5.01.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTCAAACTCCTATTAA |
Rev primer name |
SPAC26H5.01.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAACAAGAAGGTATTAAAGTT |
Amino acid length |
1063 |
Molecular weight |
120.9 |
Isoelectric point (calc.) |
8.1 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LDKVGALIL |
Localization (YFP) |
no apparent
signal |
Comments for localization |
|
Effect of LMB on protein
localization |
not determined |
Microscope used for
observation |
Leica |