Gene name |
SPAC23C11.15 |
Gene ID |
48/C01 |
Gene synonyms/obsolete |
pst2 |
Gene product |
transcriptional
regulator; sin3 family corepressor; similar to Sp pst1
(paralog); essential; involved in retroelement propagation
(required); involved in transcriptional regulation; involved
in chromatin silencing; involved in chromatin
assembly/disassembly; acetyltransferase complex; involved in
histone deacetylation |
Entry clone |
Cloned |
ORF length (unspliced) |
3352 |
ORF length (spliced) |
3228 |
Entry clone length |
3352 |
No. of intron |
2 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAC23C11.15.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAACAAACACTAGCGAT |
Rev primer name |
SPAC23C11.15.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATGGGATAAATAGTGCATTA |
Amino acid length |
1075 |
Molecular weight |
124.8 |
Isoelectric point (calc.) |
8 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LERMPCLTL/LVSGLQAKLCL |
Localization (YFP) |
nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |