| Gene name |
SPAC3H1.12c |
| Gene ID |
48/C03 |
| Gene synonyms/obsolete |
|
| Gene product |
hypothetical PHD type
zinc finger protein with Lid2 complex; zinc finger protein;
zf-PHD finger; BAH domain; involved in transcriptional
regulation; interacts physically with SET1 complex; involved
in regulation of chromatin remodeling; transcriptional
regulator; Myb family (inferred from context) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
3396 |
| ORF length (spliced) |
|
| Entry clone length |
3396 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC3H1.12.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTTGGTGATAGAAGCTGA |
| Rev primer name |
SPAC3H1.12.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACTCAACTCTCAAACAATGA |
| Amino acid length |
1131 |
| Molecular weight |
128.8 |
| Isoelectric point (calc.) |
8.3 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LPWNMRYLDL |
| Localization (YFP) |
nucleus; spindle
microtubules; SPB? |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |