| Gene name |
SPBC17D1.07c |
| Gene ID |
48/A02 |
| Gene synonyms/obsolete |
|
| Gene product |
hypothetical protein
calcium binding protein; calponin homology (CH) domain; IQ
domain |
| Entry clone |
Cloned |
| ORF length (unspliced) |
3194 |
| ORF length (spliced) |
2889 |
| Entry clone length |
3194 |
| No. of intron |
6 |
| Sequence status |
Finished |
| Sequence results |
3188G:deletion /
3189T:deletion / 3190T:deletion |
| Comments |
1 aa deletion |
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPBC17D1.07.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAAATGTTACAGAATAA |
| Rev primer name |
SPBC17D1.07.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAAACTTCCTGTTTTTCCCC |
| Amino acid length |
962 |
| Molecular weight |
112.6 |
| Isoelectric point (calc.) |
9.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LYQLSLSLCI |
| Localization (YFP) |
nuclear dots;
nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |