| Gene name |
SPAC57A7.03c |
| Gene ID |
48/A01 |
| Gene synonyms/obsolete |
SPAC167.07c |
| Gene product |
putative ubiquitin
transferase (ligase); ubiquitin-protein ligase (E3); HECT
domain; IQ calmodulin binding motif |
| Entry clone |
Cloned |
| ORF length (unspliced) |
3192 |
| ORF length (spliced) |
3090 |
| Entry clone length |
3192 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC57A7.03.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCCTTTAAGTTTTGAAGG |
| Rev primer name |
SPAC57A7.03.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAACTAAAGCCAAAACCAACA |
| Amino acid length |
1029 |
| Molecular weight |
117.7 |
| Isoelectric point (calc.) |
6 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LWQRFSSLLL/LEDIMSLSL |
| Localization (YFP) |
nuclear envelope;
nucleus>>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |